Calcein-AM from BioLegend

Product Specs
ItemCalcein-AM
CompanyBioLegend
Price Pricing Info Supplier Page View Company Product Page
Catalog Number425201
Quantity10 x 50 µg
ApplicationsFlow Cytometry (FC)

Add to Compare List

BioLegend

8999 BioLegend Way

San Diego, California 92121

United States

Phone: 1-877-246-5343 Toll-Free, USA & Canada
1-858-768-5800 International
Fax: 1-877-455-9587

Company Profile

Website: biolegend.com

(1) A human mesenchymal spheroid prototype to replace moderate severity animal procedures in leukaemia drug testingF1000ResearchNovember 6, 2023Aaron Wilson, Sean Hockney, Jessica Parker, Sharon Angel, Helen Blair, Deepali PalDorset, UK",GAAGATGGTGATGGGATTTC,OLIGO Staining Reagents,Staining Reagents, Calcein AM,BioLegend,425201 Hoechst 33342,"MERCK, Sigma Aldrich", PBS,Gibco,15400-054 FITC CD105 Antibody,BioLegend,323203 AlexaFluor

(2) 3D-printed scaffold harboring copper ions combined with near-infrared irradiation for local therapy of canceriScienceOctober 20, 2023Hao Wei, Dong Chen, Bin Han, Peng Li, Hao Jia, Lizhang Zhu, Hao Yang, Deren Lan, Wei Wei, Haibo Chen, et al.and dead cell staining, cells or organoids were double-stained in the dark with 5 μM of calcein-AM (425201, Biolegend, USA) and 5 μM of propidium iodide (PI) (421301, Biolegend) for 20 min. Then, the cells or

(3) Methods for cell isolation and analysis of the highly regenerative tunicate Polycarpa mytiligeraFrontiers in Cell and Developmental BiologyOctober 11, 2023Tal Gordon, Noam Hendin, Omri Wurtzel(Thermo Fisher, H3570) and DRAQ5 (Abcam, ab108410), to a final concentration of 20 μM. Calcein-AM (BioLegend, #425201) and Calcein Violet-AM (BioLegend, # 425203) were used as live cell labeling dye by supplementing to

(4) Truncated ring-A amaryllidaceae alkaloid modulates the host cell integrated stress response, exhibiting antiviral activity to HSV-1 and SARSCoV-2Scientific ReportsJanuary 30, 2023James McNulty, Chanti Babu-Dokuburra, Jon Scattolon, Carlos Zepeda-Velazquez, Maribeth A. Wesesky, Jill K. Caldwell, Wenxiao Zheng, Jadranka Milosevic, Paul R. Kinchington, David C. Bloom, et al.h. Organoids viability Organoids viability was analyzing using calcein AM assay (BioLegend; catalogue # 425201), according to manufacturer’s instructions. Briefly, organoids were exposed singularly in Eppendorf

(5) Human Hematopoietic Stem Cell Engrafted IL-15 Transgenic NSG Mice Support Robust NK Cell Responses and Sustained HIV-1 InfectionVirusesJanuary 27, 2023Abeynaike SA, Huynh TR, Mehmood A, Kim T, Frank K, Gao K, Zalfa C, Gandarilla A, Shultz L, Paust S.Tissue Analysis Software. 2.6. Calcein Release Assay K562 cells were stained with Calcein-AM (Cat# 425201, BioLegend, San Diego, CA, USA) and incubated with PBMCs derived from human peripheral blood or splenocytes

(6) Protocol to dissociate, process, and analyze the human lung tissue using single-cell RNA-seqSTAR ProtocolsDecember 16, 2022Ãlvaro Quintanal-Villalonga, Joseph M. Chan, Ignas Masilionis, Vianne Ran Gao, Yubin Xie, Viola Allaj, Andrew Chow, John T. Poirier, Dana Peâ€™er, Charles M. Rudin, et al.(red blood cell lysis buffer),Lonza,#10-548E Human TruStain FcX,BioLegend,#422302 Calcein AM,BioLegend,#425201 "DAPI (4,6-Diamidino-2-Phenylindole Dihydrochloride)",Invitrogen,#D1306 Ficoll Paque PLUS,GE Healthcare,#17144003-500

(7) The transcription factor Bach2 negatively regulates murine natural killer cell maturation and functioneLifeOctober 3, 2022Li S, Bern MD, Miao B, Fan C, Xing X, Inoue T, Piersma SJ, Wang T, Colonna M, Kurosaki T, et al.protein",Recombinant mouse IL-18,MBL,Catalog# B002-5, "Chemical compound, drug",Calcein-AM,Biolegend,Catalog# 425201, "Software, algorithm",Prism 9,GraphPad,https://www.graphpad.com/, "Software, algorithm",FlowJo 10,Treestar,https://www.flowjo.com/,

(8) Biomaterial-Mediated Protein Expression Induced by Peptide-mRNA Nanoparticles Embedded in Lyophilized Collagen ScaffoldsPharmaceuticsAugust 2, 2022Oude Egberink R, Zegelaar HM, El Boujnouni N, Versteeg EMM, Daamen WF, Brock R.Then, 500 µL of 3 µM calcein-acetoxymethyl ester (Calcein-AM, BioLegend, San Diego, CA, USA, Cat No. 425201) and 2 µg mL−1 of propidium iodide (PI, Sigma-Aldrich, Cat No. P4170) in PBS were added to the scaffolds

(9) Synchronized, Spontaneous, and Oscillatory Detachment of Eukaryotic Cells: A New Tool for Cell Characterization and IdentificationAdvanced ScienceAugust 1, 2022Derick Yongabi et al.the harvested cells for live imaging were resuspended in DPBS containing 2 µm Calcein‐AM (Biolegend, 425201), 2 µg mL−1 Alexa Fluor 594 wheat germ agglutinin (Thermo Fisher Scientific, W11262), 1 µm Hoechst 33342

(10) Occludin facilitates tumour angiogenesis in bladder cancer by regulating IL8/STAT3 through STAT4Journal of cellular and molecular medicineApril 1, 2022Yang F, Liu XQ, He JZ, Xian SP, Yang PF, Mai ZY, Li M, Liu Y, Zhang XD.seeded on Matrigel and incubated at 37°C for 6–8 h. The cells were then stained with 1 μM Calcein‐AM (425201, Biolegend, San Diego, CA, USA) for 30 min and imaged with a fluorescence microscope (Nikon Corporation,

(11) A Novel Anti-B7-H3 × Anti-CD3 Bispecific Antibody with Potent Antitumor ActivityLife (Basel)January 21, 2022Yan Feng et al.USA). 2.6. In Vitro Cytotoxicity Assay Target cells (5 × 103–1 × 104) labeled with 2 μM calcein-AM (425201, BioLegend, San Diego, CA, USA) were co-cultured with effector cells and the indicated concentrations

(12) Surfaceome Profiling of Rhabdomyosarcoma Reveals B7-H3 as a Mediator of Immune EvasionCancers (Basel)September 9, 2021Roxane R. Lavoie et al.B7-H3KO cells were plated in a 96-well plate and incubated 30 min at 37 °C with calcein-AM (Biolegend, 425201). The cells were then washed twice with Live Cell Imaging Solution (Gibco, A14291DJ) and kept in RPMI-1640

(13) ADAM17 Inhibition Increases the Impact of Cisplatin Treatment in Ovarian Cancer SpheroidsCancers (Basel)April 23, 2021Nina Hedemann et al.with 2× final concentration of the following dyes in the medium were added. Calcein-AM (BioLegend, #425201), final concentration of 0.1 µg/mL, was used to stain living cells; propidium iodide (PI) (BioLegend,

(14) KIR3DL3 Is an Inhibitory Receptor for HHLA2 that Mediates an Alternative Immunoinhibitory Pathway to PD1Cancer Immunology ResearchFebruary 1, 2021Rupal S. Bhatt et al.transfected Raji cells (both β2-microglobulin knockout) were stained with 1 μM calcein AM (BioLegend; cat. #425201) in PBS for 20 minutes at room temperature then washed twice with PBS and resuspended in RPMI1640 medium

(15) Serial single-cell profiling analysis of metastatic TNBC during Nab-paclitaxel and pembrolizumab treatmentBreast Cancer Research and TreatmentJanuary 1, 2021Jiehui Deng et al.BioLegend) and single cells were obtained and stained with DAPI (Cat # 422801, Biolegend) and Calcein (Cat # 425201, Biolegend). The BD Aria III sorter was used with a 100 μm nozzle to sort live (DAPI- Calcein+) single

(16) Natural display of nuclear-encoded RNA on the cell surface and its impact on cell interactionGenome biologySeptember 10, 2020Huang N, Fan X, Zaleta-Rivera K, Nguyen TC, Zhou J, Luo Y, Gao J, Fang RH, Yan Z, Chen ZB, et al.following the manufacturer’s protocol. Cells were stained with Calcein AM (2.5 μM, Biolegend cat. #425201) for 15 min at 37 °C for live-cell fluorescent tracking. Meanwhile, oligonucleotide probes were denatured

(17) Robust differentiation of human pluripotent stem cells into endothelial cells via temporal modulation of ETV2 with modified mRNAScience advancesJuly 1, 2020Wang K, Lin RZ, Hong X, Ng AH, Lee CN, Neumeyer J, Wang G, Wang X, Ma M, Pu WT, et al.with h-iEC media. After 6 hours, cells were incubated with 1 μM Calcein-AM (BioLegend, catalog no. 425201) for 10 min and then imaged using a fluorescence microscope. Numbers of branches were counted by ImageJ. In

(18) Analyzing the Quenchable Iron Pool in Murine Macrophages by Flow CytometryBIO-PROTOCOLMarch 20, 2020Michael Riedelberger, Karl Kuchler8-hydroxyquinoline (Sigma-Aldrich, catalog number: H6878) 28. Calcein-AM (BioLegend, catalog number: 425201) 29. Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D2438) 30. Trypsin solution 10x (Sigma-Aldrich,

(19) Serum-Free Culture System for Spontaneous Human Mesenchymal Stem Cell Spheroid FormationStem Cells InternationalOctober 15, 2019Guoyi Dong et al.measure the cell viability, hMSC spheroids at days 1, 3, and 6 were stained with Calcein-AM (BioLegend, 425201) and PI (Sigma, P4170-25MG) according to the manufacturer’s protocol. Brieﬂy, spheroids were incubated

(20) Efficient tumor killing and minimal cytokine release with novel T-cell agonist bispecific antibodiesmAbsMay 1, 2019Trinklein ND, Pham D, Schellenberger U, Buelow B, Boudreau A, Choudhry P, Clarke SC, Dang K, Harris KE, Iyer S, et al.the co-culture assay. Target cell lines were fluorescently labeled with 5 μM Calcein AM (Biolegend #425201) and incubated in with 2.5 mM probenecid (Sigma #P8761). Each biological assay was set up in 96-well

Be the First to Write a Review!

Description

BioLegend

Citations (21)

Reviews

Calcein-AM from BioLegend

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map